The maize genetics community needs your help! POPcorn a special resource being developed with the goal of putting all maize-related information in one easy-to-use place. To help make POPcorn the best possible resource, they need feedback on ease of use.
Not a maize geneticist or breeder? The resource might still be of use to you if you study another crop or if you are just interested in learning more about a particular plant gene and what it does.
Any feedback that you can provide would be a big help to the POPcorn team. POPcorn is funded by NSF.
Start at the POPcorn homepage: http://popcorn.maizegdb.org/ and try out the suggested tasks below. Feel free to come up with your own tasks to try out, too. Are they easy to do? Are you able to find the desired information? The gene sequence for waxy is provided below, but feel free to try any nucleotide or amino acid sequence of interest to you.
- Are there any genetic stocks containing insertions or deletions in your DNA sequence.
- Are there any gene models associated with your sequence? Is there more than one?
- Is there evidence that your gene is expressed?
- Is your DNA sequence of interest possibly duplicated within the maize genome? (Try lowering your e-value)
- Find your DNA sequence on the genome browsers. Is it possible to design PCR primers for your DNA sequence while you are within the browser. Try downloading your DNA sequence and its flanking sequence into a FASTA file.
- Can you find the syntenic regions for your DNA sequence in rice and sorghum?
>lcl|AF267643 Zea mays starch synthase GBSSI (mwx) mRNA, partial cds
GTGTCGACGCCCGTGAAGGCCAAGGCGCTGAACAAGGAGGCGCTGCAGGCGGAGGTCGGGCTCCCGGTGGACCGGAACATCCCGGCCTGGGTGGCGTTCATCGGCAGGCTGGAAGAGCAGAAGGGACCCGACGTCATGGCGGCCGCCATCCCGCAGCTCATGGAGATGGTGGAGGACGTGCAGATCGTTCTGCTGGGCACGGGCAAGAAGAAGTTCGAGCGCATGCTCATGAGCGCCGAGGAGAAGTTCCCAGGCAAGGTGCGCGCCGTGGTCAAGTTCAACGCGGCGCTGGCGCACCACATCATGGCCGGCGCCGACGTGCTCGCCGTCACCAGCCGCTTCGAGCCCTGCGGCCTCATCCAGCTGCAGGGGATGCGATACGGAACGCCCTGCGCCTGCGCGTCCACCGGTGGACTCGTCGACACCATCATCGAAGGCAAGACCGGGTTCCACATGGGCCGCCTCAGCGTCGACTGCAACGTCGTGGAGCCGGCGGACGTCAAGAAGGTGGCCACCACCTTGCAGCGCGCCATCAAGGTGGTCGGCACGCCGGCGTACGAGGAGATGGTGAGGAACTGC
You can post any comments you have on POPcorn here and I’ll pass them along, or you can send Feedback directly to the POPcorn team. They send their thanks in advance for your much needed feedback!
Want to get updates about maize genetics resources? Become a fan of MaizeGDB on 
I found the FASTA format amino acid sequence on NCBI of my current gene of interest: Maize hemoglobin.
I chose a biology search and checked all the boxes to see what each sub-search would get me. That took me to a page that said “Your job has been submitted to POPcorn.” with links to a status page and result page. Clicking on “Link to result page” took me to another page where I had to click on “Link to result page” again – this extra page should be removed. I like that a results link to save or share is provided on the results page. How long is this search result available for?
There are no genetic stocks with insertions or deletions in my gene 🙁
There is a gene model at MaizeSequence. My gene is on maize chromosome 6, has 1 splice variant, and 6 orthologues (in Arabidopsis, Brachypodium, rice, and sorghum).
I’ll work on the other tasks later on. The results are harder to read than I expected.